Review




Structured Review

Sequenom massarray snp genotyping technology
Massarray Snp Genotyping Technology, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/massarray+platform/pmc12593843-228-2-1
Average 86 stars, based on 1 article reviews
massarray snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Sequencing:

Article Title: The NEI/NCBI dbGAP database: Genotypes and haplotypes that may specifically predispose to risk of neovascular age-related macular degeneration
Article Snippet: .. Genotyping was performed by both direct sequencing and Sequenom iPLEX system technology. ..

Article Title: Molecular test of Paget's disease of bone in families not linked to SQSTM1 gene mutations
Article Snippet: .. Genotyping of SNPs was done using the Sequenom MassARRAY SNP Multiplex Technology, completed by Sanger sequencing for missing data at the Plateforme de Séquençage et de Génotypage des Génomes du Centre de Recherche du CHU de Québec, as published ( ). ..

Article Title: Fine mapping of genes within the IDDM8 region in rheumatoid arthritis
Article Snippet: .. SNPs were genotyped using Sequenom MassArray genotyping technology, according to manufacturer's instructions, whereby the genomic sequence containing the SNP is amplified by PCR [ ]. ..

Multiplex Assay:

Article Title: Molecular test of Paget's disease of bone in families not linked to SQSTM1 gene mutations
Article Snippet: .. Genotyping of SNPs was done using the Sequenom MassARRAY SNP Multiplex Technology, completed by Sanger sequencing for missing data at the Plateforme de Séquençage et de Génotypage des Génomes du Centre de Recherche du CHU de Québec, as published ( ). ..

other:

Article Title: Whole-genome resequencing uncovers population structure and candidate molecular markers for litter size in hetian sheep
Article Snippet: The Sequenom MassARRAY ® SNP genotyping technology was employed to validate the detection rates of 23 targeted SNP loci.

Article Title: PIK3CA mutations, phosphatase and tensin homolog, human epidermal growth factor receptor 2, and insulin-like growth factor 1 receptor and adjuvant tamoxifen resistance in postmenopausal breast cancer patients
Article Snippet: PIK3CA mutation status was assessed by using Sequenom mass spectrometry–based genotyping technology for PIK3CA hotspot mutations in exon 9 (E542K and E545K) and exon 20 (H1047L and H1047R).

Amplification:

Article Title: Fine mapping of genes within the IDDM8 region in rheumatoid arthritis
Article Snippet: .. SNPs were genotyped using Sequenom MassArray genotyping technology, according to manufacturer's instructions, whereby the genomic sequence containing the SNP is amplified by PCR [ ]. ..

Polymerase Chain Reaction:

Article Title: Fine mapping of genes within the IDDM8 region in rheumatoid arthritis
Article Snippet: .. SNPs were genotyped using Sequenom MassArray genotyping technology, according to manufacturer's instructions, whereby the genomic sequence containing the SNP is amplified by PCR [ ]. ..



Similar Products

99
New England Biolabs nebnext ultra tm ii rna library prep kit genotypic technologies
Nebnext Ultra Tm Ii Rna Library Prep Kit Genotypic Technologies, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/NEBNext+Ultra+II+RNA+Library+Prep+Kit/bio_rxiv__64898__2026__04__06__709730-107-17-17
Average 99 stars, based on 1 article reviews
nebnext ultra tm ii rna library prep kit genotypic technologies - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Sequenom massarray snp genotyping technology
Massarray Snp Genotyping Technology, supplied by Sequenom, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/massarray+platform/pmc12593843-228-2-1
Average 86 stars, based on 1 article reviews
massarray snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Amersham Life Sciences Inc technologies discovery genotyping
Technologies Discovery Genotyping, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/discovery+genotyping+technologies/sec_filing____40545_slash_000119312503069884_slash_d425-1085-12-16
Average 86 stars, based on 1 article reviews
technologies discovery genotyping - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology
Plant Genotypes Seed Stocks Authentication Plants Phospho Eif4e Rabbit Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/Phospho-eIF4E+(Ser209)+Antibody/pmc11914046__41467_2025_57615_MOESM2_ESM-52-1-9
Average 96 stars, based on 1 article reviews
plant genotypes seed stocks authentication plants phospho eif4e rabbit cell signaling technology - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Thermo Fisher high-throughput snp genotyping with microarray technology
High Throughput Snp Genotyping With Microarray Technology, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pmc11675768-136-6-0
Average 90 stars, based on 1 article reviews
high-throughput snp genotyping with microarray technology - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Qiagen taqman snp genotyping assay life technologies n a rneasy kit qiagen
Taqman Snp Genotyping Assay Life Technologies N A Rneasy Kit Qiagen, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/RNeasy+Mini+Kit/pm39255062-728-170-179
Average 99 stars, based on 1 article reviews
taqman snp genotyping assay life technologies n a rneasy kit qiagen - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Danaher Inc rhamp snp genotyping technology
Rhamp Snp Genotyping Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pm38332006-106-39-43
Average 86 stars, based on 1 article reviews
rhamp snp genotyping technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Danaher Inc genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology
Genotyping Primers Adar Reverse Gccacttctccctgactcctg Integrated Dna Technology, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/Genotyping+Technology/pm38128529-262-33-38
Average 86 stars, based on 1 article reviews
genotyping primers adar reverse gccacttctccctgactcctg integrated dna technology - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results